Review



first strand human cdna cerebellum, cortex thalamus  (BioChain Institute)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    BioChain Institute first strand human cdna cerebellum, cortex thalamus
    First Strand Human Cdna Cerebellum, Cortex Thalamus, supplied by BioChain Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+thalamus+cdna/first+strand+human+cdna+cerebellum++cortex+thalamus/pmc06710402__Data_Sheet_1-5-14-18
    Average 90 stars, based on 1 article reviews
    first strand human cdna cerebellum, cortex thalamus - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Alsin, the Product of ALS2 Gene, Suppresses SOD1 Mutant Neurotoxicity through RhoGEF Domain by Interacting with SOD1 Mutants
    Article Snippet: .. The second fragment, corresponding to the region from the first EcoRI site to the NheI site of alsin LF, was obtained from human thalamus cDNA (BioChain) by PCR using a sense primer (GCTTCCATAGTGGAGCAGTGACAGAC) and an at SO U T H E R N IL L IN O IS U N IV on M arch 5, 2015 http://w w w .jbc.org/ D ow nloaded from antisense primer (GCGGCCGCCTCAATGAGGCTCCATGCTGACC). ..



    Similar Products

    94
    TaKaRa fetal brain cdna
    Fetal Brain Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+thalamus+cdna/Human+Brain%2C+Thalamus+QUICK-Clone+cDNA/us08354414-1566-15-18
    Average 94 stars, based on 1 article reviews
    fetal brain cdna - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    90
    BioChain Institute first strand human cdna cerebellum, cortex thalamus
    First Strand Human Cdna Cerebellum, Cortex Thalamus, supplied by BioChain Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+thalamus+cdna/first+strand+human+cdna+cerebellum++cortex+thalamus/pmc06710402__Data_Sheet_1-5-14-18
    Average 90 stars, based on 1 article reviews
    first strand human cdna cerebellum, cortex thalamus - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    BioChain Institute pcr ready first strand human cdna from cerebellum, cortex and thalamus
    Pcr Ready First Strand Human Cdna From Cerebellum, Cortex And Thalamus, supplied by BioChain Institute, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+thalamus+cdna/pcr+ready+first+strand+cdna/pmc06710402__Data_Sheet_1-5-1-18
    Average 90 stars, based on 1 article reviews
    pcr ready first strand human cdna from cerebellum, cortex and thalamus - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    94
    TaKaRa human ant cdna
    Human Ant Cdna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+thalamus+cdna/Human+Brain%2C+Thalamus+QUICK-Clone+cDNA/pmc02676352-63-4-16
    Average 94 stars, based on 1 article reviews
    human ant cdna - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    TaKaRa human thalamus cdna library
    Human Thalamus Cdna Library, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+thalamus+cdna/Human+Brain%2C+Thalamus+QUICK-Clone+cDNA/pm19530894-34-16-20
    Average 94 stars, based on 1 article reviews
    human thalamus cdna library - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    94
    TaKaRa human brain cdna panel
    Human Brain Cdna Panel, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/human+thalamus+cdna/Human+Brain%2C+Thalamus+QUICK-Clone+cDNA/pm19383498-26-8-17
    Average 94 stars, based on 1 article reviews
    human brain cdna panel - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results